DNA Decoder

Ready for my DNA strand?  Too bad, you're getting it anyway:

AACGTTAGTACCAAGGGAACGGAATTTCAAGTGTGAGCTGATCCATCCCCTCTGTATGACGT

Good luck!

Historical Influences on Darwin

1. I believe that Malthus had the most influence on Darwin and his work: Through his studies of the relationship between population and food supply, Malthus provided the answer to his theory of natural selection.  Without this answer, Darwin’s theory would have lacked an explanation.

2. Malthus was mainly interested with population growth.  He pointed out that while populations tend to increase in size, the sources of food tend to stay the size they are.  In his written work An Essay on the Principle of Population, he discussed this issue, stating that the size of a population is always checked by the availability of resources.  Although he acknowledged that humans can make efforts to increase this availability, he promoted methods to reduce the population itself instead of accommodating it.  He classified these methods as either positive, where the death rate was increased, or preventative, where the birth rate was decreased.

[What I find interesting is that Malthus was willing to tolerate the decrease of population through the allowance of war, disease, starvation, and even infanticide.  Admittedly, his insistence that essentially killing off part of the population was more practical than finding ways to accommodate a larger one disturbs me slightly.  Although it seems that he is concerned for the betterment of humankind as a whole, I can’t help but feel he didn’t have a high regard for the lives of individuals.  What is more interesting is despite his concern for betterment, he did not believe in eugenics; he found the idea impractical and unrealistic.  I would have thought that someone with his outlook would be very supportive of this practice, but even though he promoted the elimination of individuals to decrease population, it doesn’t seem like he was very concerned with who was eliminated or who remained living (although what I read does suggest that several positive checks, including starvation and disease, would mostly affect the poor).]

Sources: http://www.econlib.org/library/Enc/bios/Malthus.html

   http://www.victorianweb.org/economics/essay.html

3. Two bullet points especially affected by Malthus’ findings are

• Something is keeping organisms from reproducing to their full potential
• This “something” is limited resources

Malthus’ findings allowed Darwin to add these points to his theory.  Without them, he would have never been able to explain how natural selection would be able to happen.

4. Darwin would not have been able to move forward without Malthus’ findings.  He expanded on Malthus’ idea by applying it to the animal population, and concluded that because some species had better access to the limited resources (because they are better placed in their environment, or had traits that were better adapted to their environment), they were able to survive the species who did not.  These surviving species were able to reproduce and pass these better traits down to their offspring.

5. Because the most widely accepted explanation of variation within species was based on a literal interpretation of the Bible, Darwin was very hesitant to publish his theory of natural selection.  The former explanation proposed that all species had been fixed since the time they had been created, meaning there had been no change since they had appeared on earth.  As well as going against the teachings of the Bible, Darwin’s theory challenged all prevailing beliefs about natural history in Great Britain at the time.  If he made this theory public, he thought would be seen as a heretic.  Furthermore, he did not feel that he had enough data to support his theory if he did decide to publicize it.  It wasn’t until many years later, when Alfred Wallace began writing essays about natural selection, that Darwin finally published his studies in his work “The Origin of Species”.

Test post: hello!

This is a test post to see if it will show up on my blog.

Hi everyone, my name is Maia.  I'm taking Anthro 101 this summer to complete my GE.  I'm a theatre major, and it's definitely an interesting field to be in.  If any of you came to see COC's "Rent", you might have seen me running around in shiny blue tights and screaming foul words at the guy with the camera and glasses.

I'm excited to be taking this class this semester.  Hope to be hearing from you all!