To help you understand, this is how I generally handled Anthro 101:

I pray you do better.

The End

I finished my final.  I finished the last round of extra credit.  I'm trying to finish this last English paper while listening to Bad Suns on Spotify, who are surprisingly very good.  I can't believe I'm alive right now.  I suppose I'm still in charge of this blog...so I'll keep it running.

I don't think I've ever thought as much as I have in this class.  I mean that's saying something, too--I thought I'd never think as much as I did during summer philosophy, but philosophy is all up in the air.  This is definitely not in the air.  And I am so tired right now I don't know what I'm saying.

This class was fun.  Thanks, Prof. Rodriguez.

Human Variation and Race

Hot climates can be very detrimental to human homeostasis.  When exposed to heat for long periods of time, the human body can lose up to half a gallon of water each thirty minutes through sweating, resulting in rapid dehydration.  Heat exhaustion, the loss of bloodflow to the internal organs due to an increase of bloodflow to the skin, and heat stroke, where the body's internal thermostat stops functioning, both result from prolonged exposure to heat.  If these unhealthy effects are left untreated, this can cause the body's core temperature to pass a safe limit, resulting in hyperthermia.  This leads to the failure of the internal organs and potential death.

Four human adaptations in response to hot climates are:

• A larger body surface area, which is a developmental adaptation.  According to the findings of biologist Joel Allen, mammal populations in warm climates near the equator had longer limbs than those living farther from the equator, in colder climates.  The same characteristics are found in human populations in the same regions; an example of this is the Samburu in Northern Kenya, who possess long limbs and a more linear body shape.  This is because a larger body surface area, created by longer limbs, allows humans to release larger amounts of body heat at a given time, so they can say cool in hotter climates.

 The Samburu (above) possess long limbs and linear bodies, providing a larger

bodily surface area from which excess heat can be released.

• Sweating, which is a short term adaptation.  A period of sweating only lasts as long as the heat is present, and will stop once the climate has changed (and the external and internal temperatures have gone down).  This is also known as evaporative cooling, and while it is effective for short amounts of time, the water and minerals lost by sweating will eventually need to be replenished.

Sweating is essential to keeping the body cool in hot temperatures, especially

during periods of physical exertion.

• The change of salt concentration within sweat, which is a facultative adaptation.  Once a person is exposed to high levels of heat for a long period of time, eventually the concentration of salt in their sweat will decrease, allowing it to last longer in their body, while the amount of water released through perspiration increases.

Although I don't have an image depicting the salt concentration within sweat, I gathered my information from the anthro.palomar.edu website, as well as one outside source.  Below is a graph from the Journal of Applied Physiology, which shows the findings of a study meant to "determine the effect of active heat acclimation on the sweat osmolality and sweat sodium ion concentration vs. sweat rate relationship in humans."  The study followed eight males over a 10-day period, who exercised each day in hot weather.  The graph shows that while the sodium ion concentration in their sweat decreased over the 10 days, the sweat rate increased.

Source: http://jap.physiology.org/content/103/3/990

• The use of air conditioning and insulated shelter, which is a cultural adaptation.  This type of adaptation has nothing to do with the workings of the human body; however, shelter and conditioned air provide external barriers from heat.  A structure with an insulated roof and walls prevent heat from coming into the structure and cool air from escaping.  An air conditioning unit cools the air within the structure, allowing the body to cool down and maintain a proper temperature.

The ice blocks which make up igloos contain air pockets, which provide effective

insulation.  When warmed by body heat, the internal temperature of an igloo

can surpass the outside temperature by over 100 °F.

Air conditioning units collect air from outside a structure, cool it, and pipe it 

into the structure, producing an artificial climate inside.

By widely studying human variation, we can see the ways in which humans adapt to conditions, and in some cases how quickly they are able to adapt.  By using these findings, we are able to predict human evolutionary patterns resulting from certain environmental stresses.  In the case of heat acclimation, we can use the information gathered from people who are naturally more able to operate in a hotter climate, and use this information to create new technologies which help those who are not fit for these climates survive in them.

The idea of race comes from the physical differences expressed in humans.  Although we are all of the same species, we categorize ourselves by the shade of our skin, our facial structures, our body types, and so forth.  However, our real differences don’t stem from race itself—race is a byproduct of human adaptation.  Because groups of humans in different geographic locations managed to adapt to different environmental influences, their very appearances became different.  The variations resulting from a hot climate are a good example of these differences: those in hotter climates may develop a taller, more linear body structure to increase bodily surface area than those in colder climates, who may be shorter and stockier to retain body heat.  How these variations came to be, and the environmental conditions they are suited for, is a better way of mapping the differences between human populations than the variations themselves.  The decision to categorize people using these physical differences, these variations, is not scientific—it is a social decision, based on a desire for generalization.

Language Experiment

I found the first part of this experiment quite easy during the first few minutes, but it became frustrating soon after.

At the beginning, the conversation was very one-sided, which made it easier for me, since all I had to do was grunt and wave my hands to show my partner I was listening.  However, when she suggested doing something that I didn't want to do, grunting suddenly was not enough.  By the time I got her attention and gestured for her to stop talking, she had already moved on to the next idea.  I could not tell her what I was stopping her for, since I had no way of repeating what she had said in her previous statement.  I tried miming the issue, but since we had already moved on to the next part of the conversation, she still didn't know what I was referring to.

When she began speaking directly to me, my partner addressed me mostly in yes or no questions.  Although this made our conversation easier to carry, I could tell she was irritated by the fact that she had to spend so much time asking me questions about what I was thinking or what I was referring to, when I could have told her within a few sentences.  She was not the only one who was irritated, either—after a few attempts at communicating, I started feeling very childish, being unable to express myself through speech.  

To make the conversation more interesting, I told her (in words) to ask me a question that would be difficult to answer without words.  In response, she asked me how I felt about being mixed-race.  Since I have no issues with it, I jumped around and smiled.  When she asked me why I felt that way, I found I had no way of explaining the reason.  Without some kind of spoken language, I could not describe the fine points of why I was comfortable with my race, I could only tell her that I was happy with it.  As a result, I was silent for a very long time, and could only communicate my frustration to her by frowning.

Even though I could communicate some level of emotion with my body, voice, and face (like happiness, anger, disappointment, excitement) during this conversation, I couldn't give her any specificity about what I was feeling, or exactly why I felt it.  Furthermore, I was completely unable to explain myself when it came to more complex topics, such as why I felt a certain way.

That being said, if this had been a meeting of two people from two different cultures, then my partner would have had the upper hand in expressing complex ideas.  With spoken language, a person is able to describe things in a much more detail.  Also, when it comes to more abstract ideas, it would be impossible to have meaningful discussions without a spoken language.  Even if those around him held the same ideas, they have no way of telling each other this, since they could not describe the idea in the first place.

Most likely, the person with the ability to speak would view the person without that ability as barbaric, or unintelligent.  Judging by my actions during our conversation, the non-speaker’s becoming frustrated at their inability to express their thoughts would probably be seen as impulsiveness or lack of control to the speaker.  Also, even if the person who lacked a spoken language had a mental capacity equivalent to the speaker’s, he would have no way of making this known, giving the speaker the impression that he had never thought about anything more complex than what he could communicate non-verbally.

There are several different disorders which affect the ability to understand and communicate through speech, such as aphasia, and those who are mentally challenged may also find it harder to communicate through spoken language.  Very young children, who are just learning to speak, also are unable to communicate using language—they express their needs only through body language and nonverbal sounds, such as crying, laughing, and crawling.  As a result, those with higher language skills may use simpler language to accommodate these sorts of people, and communicate through more frequent body language and enhanced facial expression.

***

The second part of the experiment was cut a bit short from 15 minutes, since neither of us could not stop laughing throughout the conversation.

Since I had the entire English language at my disposal this time, there were no problems with communicating more complex ideas.  Even so, my partner found it very difficult to sustain a conversation with me.  Despite my telling her beforehand that I had to talk without using gestures or voice changes, my lack of physical reactions still made her a bit uncomfortable.  No matter what she said to me, I sounded very disinterested and bored whenever I responded.  Also, no matter how hard I tried, I could never speak without changing my voice somehow; I've grown so accustomed to changing my voice for emphasis that it was almost impossible to keep it at a constant pitch.  After a few minutes, we could not continue the conversation; my partner told me I sounded “too much like a robot” to be taken seriously.

Language is not only about verbally expressing thoughts, it’s also about expressing how you feel about those thoughts.  Even if you stated that you were excited, there is something about speaking in monotone with no facial or bodily expression that is not convincing.  Humans are naturally very excitable animals, and we tend to become engaged in whatever thoughts or activities we’re experiencing.  This involves changing our voice pitch, tone, and moving our bodies.  If we do not include these things in our speech, we seem detached, and are viewed as insincere.

Frankly, using body language is a time-saver.  By acting excited, you save yourself a few minutes of verbally explaining how excited you feel.  In a way, during normal speaking with pitch variation and gestures, it’s almost as if you are speaking two languages at once.  If this is true, then it would take twice as long to explain anything using only verbal or body language.  Judging by the outcomes of this experiment, I would say this is a valid assumption.

There are certain medical conditions which impair a person’s ability to read body language.  For example, Asperger syndrome affects a person’s reactions to gestures, facial expression, and posture; they may not understand or recognize the other person’s reactions, and be viewed as insensitive.

Because humans are able to use and recognize body language, we are able to gauge the importance of a person’s speech.  Body language allows us to see if a person is truly invested in what they are saying, and whether they are excited, dishonest, or disappointed.  And although body language itself is not sufficient for expressing ideas, it is useful for signaling if we are in pain or in trouble, which can be extremely important in situations where we need assistance and are unable to speak.

If there was a situation where a listener wanted hear to a speaker objectively, without any sign of opinion or preference, I think ignoring body language would be useful.  This way, the listener would not come to any quick conclusions about the attitude of the speaker based on his movements or how he looks as he is speaking.  Also, the inability to read body language can be very useful to a liar—of course, this can cause many problems for the person who is being lied to.

The Piltdown Hoax

1.     In the early 1900s, Charles Dawson, an amateur archaeologist, discovered a pile of gravel in the small English town of Piltdown which contained the bones and tools of a Neanderthal—the first that had been found in Britain.  The bone which attracted the most attention was a jawbone fragment, which mostly resembled an ape’s, and a piece of a skull.  However, the few teeth that were still attached to the jawbone were short and blunt, more like a human’s, and a reconstruction of the skull showed that it was shaped like a cross between an ape’s and a human’s, since the cranium was more human-like in size and shape.  The primate these bones belonged to was named the “Piltdown Man”, after the town they were found in, and was said to be the “missing link” between apes and humans.  The British at the time craved some kind of proof that they too had Neanderthal remains somewhere in their country, like so many others.  They were excited at the Piltdown findings and were very hasty about validating their authenticity.  However, in later years, more accurate ways of dating fossilized remains were discovered, and the Piltdown findings were tested using these methods.  To the surprise and dismay of many scientists who had believed in the findings, many of the pieces collected from the Piltdown site were found to be only 100,000 years old at most, compared to the millions of years that Dawson had claimed.  Furthermore, the fragment of jawbone was found to be less than 100 years old; it had been stained to look aged, and the teeth had been filed down to appear more human-like.

The primary suspects of the Piltdown hoax are Charles Dawson, his assistant Arthur Woodward, and surprisingly, Arthur Conan Doyle.  Prior to the hoax, Doyle had fallen out of the scientific community for his beliefs in spiritualism.  His notions of spirit photography had been laughed at by other scientists, who claimed that his spirit photographs were not evidence at all.  It is suspected that he wanted to get even with these scientists by having them pass false, manufactured evidence as real, in order to demonstrate that they could not recognize evidence whether it was real or not.  Doyle’s novel, “The Lost World”, includes several methods and processes which match those of the Piltdown Hoax, as well.

Dawson and Woodward, since they were the ones who initially found the site in Piltdown, are the suspects who have received the most scrutiny.  After his death, Dawson was proven to have been a fraud and a swindler before Piltdown; some of his previous archaeological discoveries had also been fakes.  In the NOVA transcript, it’s stated that Dawson was looking for some kind of archaeological discovery which he could publicize to build academic credibility for himself.  By finding the remains of the “Earliest Englishman”, he would be able to gain this credibility.  Although Woodward is also suspected, he continued to dig at the Piltdown site for many years after Dawson had died, which might have been a sign he had no knowledge of the hoax.

The hoax was a terrible embarrassment to the British scientific community, who had embraced its truth for so long, and for the scientists who had based their studies on it.  These false findings had led them down pointless paths of study, using “facts” of human evolution that turned out to be false, and many major discoveries of bones and artifacts were ignored due to these falsehoods.  The event also caused some distrust of scientists among the general community, suggesting that they could not be trusted when it came to the larger issues of human evolution, or any other major issue for that matter.

2.     The two most prominent motives for this hoax were to get revenge, and to become famous.  These are two very human desires, and unfortunately they both managed to tarnish the reputation of the scientific community to an extent.  The suspects in this hoax wanted something for themselves, whether it was seeing their enemies defeated or becoming famous, for the sake of having it; it had nothing to do with increasing the knowledge of our origins.  And because the perpetrators were successful, scientists worked with false information for over 40 years.  Not only were the false discoveries detrimental at the time they were made, they affected scientific studies for many years afterwards.

The hoaxers were not the only ones at fault, however.  At that time, Neanderthal remains had been found in countries such as Germany, Spain, and France, but none had been found in Britain.  Once the Piltdown man was discovered, Britain’s scientific community was more than willing to validate the find, as it would show their country had just as much to do with the evolution of man as the others.  Once it seemed like there was sufficient evidence to conclude the bones and artifacts were authentic, the matter was settled.  The eagerness of the scientific community to establish their own place in the evolutionary timeline caused them to overlook several things which might have discredited the Piltdown Man.

3.     Throughout the years, there was still some doubt about the authenticity of the Piltdown Man, though it was never widely discussed.  However, in the early 1950s, Professor Kenneth Oakley used fluorine analysis to conduct further dating studies on the bones found at Piltdown. 

As a bone sits buried in the earth, it will absorb the fluorine found in groundwater; the longer it stays buried, the more fluorine it will incorporate.  In result, bones found in the same site should contain the same amount of fluorine, given they absorbed it at the same rate, and can be dated against each other using their fluorine levels.  He found that a human skull unearthed at the site dated further back than he piece of jawbone (which would soon be discovered to have belonged to an orangutan).  In reality, the jawbone was less than 100 years old.

Following Oakley’s discovery, a full analysis was launched on the Piltdown man and the accompanying bones.  Using microscopes, scientists discovered the teeth on the jawbone, as well as a canine tooth supposedly belonging to the jawbone, had been filed down to resemble human teeth.  Also, pieces of the jawbone which would have made it clear it belonged to an ape had been broken off.

 

4.     As long as scientific study is conducted by humans, I don’t think the human factor can ever be totally removed.  Even if most of the scientific community is honest, and their only motive is to make discoveries for the betterment of mankind, there will always be one of two people who don’t make that their highest priority.  And even if all of them are honest, there is still the possibility of honest error. 

If there was a way to remove the human factor from science, yet leave the integrity and the passion which scientists have intact, I would support it.  The thing that drives scientists to make discoveries and pursue their studies for so long is the very thing which causes them to make mistakes—passion, emotion, the desire for something greater.  Only the perpetrators of the Piltdown Hoax pursued that desire in the wrong way.  As long as this desire is tied to what compels scientific study, I think the benefits of the human factor ultimately outweigh the drawbacks.

5.     A life lesson to take away from this event would be: don’t be too eager to accept something as truth just because you want it to be true, and ignore everything which tells you it’s false.  According to the NOVA transcript, the “desire to find the earliest Englishman had blinded the scientific establishment”.  Scientists were willing to accept the Piltdown Man as genuine not because the proof was irrefutable, but because it validated something they wanted to be true.  In other words, they had come to a conclusion first, and were looking for evidence to support that conclusion only.  Not only does this not follow the scientific method, it does not follow common sense.  Critical thinking requires the thinker to take all the facts into account, and make decisions based on those facts as a whole, not to make a decision and then find facts which support that decision.

Dentition Patterns of Primates

A.    Lemurs (Promisian) are found exclusively on the island of Madagascar and the Comoro Islands, where they were most likely brought by human travelers.  Here, they don’t have to contend with other, more developed primates.  Their habitats range from rainforests to very hot and dry regions.  Their diets consist of a mix of fruit, leaves, and small prey such as frogs, eggs, and hatched birds.

Spider monkeys (New World Monkey) reside in the tropical forests of Central and South America, specifically in the upper layers of the rainforests.  They are one of the largest types of New World monkeys.  Their diet consists mostly of fruits and nuts, but they will occasionally eat insects, bird eggs, and honey when food is not easy to come by.

Baboons (Old World Monkey) live in several, varied regions of Africa, ranging from savanna grasslands to tropical rainforests.  Although they do climb trees to sleep and find food, most of their time is spent on the ground.  Their diet includes fruit, grasses, and roots, as well as birds, rodents, and even larger prey like antelopes or sheep.

Gibbons (Lesser pe) are found in Northeastern India, Southern China, and Borneo, in tropical rainforests.  They rarely descend to the ground, spending most of their lives in the trees, where they find most of their food.  Gibbons eat mostly fruits--figs, especially--but will sometimes consume leaves and insects.

Chimpanzees (Great ape), who are the closest living relatives of humans, reside in the African rainforests, woodlands, and grasslands.  They are very social animals, living in groups of several dozen.  Most of their eating and sleeping is done in the trees.  Their diet is mainly vegetarian, yet includes insects, carrion, and eggs.  Occasionally, they will eat other primates, and even other chimpanzees.

B.   What these primates have in common is that they are all heterodont, meaning they possess several kinds of teeth in the tooth row.  Each of these primates have a combination of incisors, canines, pre-molars, and molars.  This trait sets them apart from other mammals, who typically have a less varied collection of teeth.

C.   This shared trait can be attributed to these primates being omnivorous.  Their diet is less specialized; it does not focus on only meat or vegetables, but both.  Therefore, their teeth must be suited for biting and chewing a wide variety of foods.

D.

Bottom teeth of a lemur.  Notice how the front teeth protrude

outward much more than any of the other listed primates.

A spider monkey.  This primate's teeth seem to be grouped much

closer to each other than the lemur's.

A baboon.  This primate has the largest canines of the five.

A gibbon.

A chimpanzee.  Compared to the rest of its teeth, the chimpanzee

seems to have the shortest canines.  Its jaw is also shorter.

Homologous and Analogous Traits

1.

a. Two species which possess a homologous trait are humans and bats.  Humans are mammals and a type of primate.  Bats are winged mammals; unlike most winged mammals, bats are the only mammals who can travel great distances through flight, instead of gliding for short distances.

b. Just like bats, the human forelimb extends into five digits, or fingers.  However, these digit-bones are smaller, thicker, and sturdier than those of a bat.  Also the thinner, longer bones of a bat are more curved, and the tissue between them forms a thin, webbed wing, giving them the ability to fly; this allows them to catch prey more easily, as well as escape predators.  The function of the human bone structure is to grasp objects and perform tasks which require detailed work and finer movements.

c. The common ancestor of these two species was a reptile, who possessed a very similar bone structure in the forelimbs as both of its offspring.

A human male.

A bat. Notice the similarity of the bone

structure of the wing and that of a human hand

2.

a.  Two species which possess an analogous trait are bats and butterflies.  Bats, as mentioned earlier, are mammals capable of flight.  Butterflies are winged insects, which develop from larvae, or caterpillars; their wings develop from small wing disks found inside the larvae.

b.  While bats possess a webbed wing formed from skin stretched across the bones of their forelimbs, butterflies have wings formed by two membranes layered on each other, supported by veins and covered with colored scales.  Although the wings of both species serve the same purpose (flight), butterflies have four wings, while bats have only two.

c.  The ancestor of these two species did not have wings. Their similar trait, wings, do not resemble each other.  If their common ancestor had had wings, the two separate species would have retained the basic wing structure of that ancestor.  Yet, because these two species evolved into winged creatures separately due to similar environmental pressures, and not a common ancestor, the structure is very different.

A bat, same as one picture above.

A butterfly. Note the veins in the wings,

wing shape, and number of wings.

DNA Decoder

Ready for my DNA strand?  Too bad, you're getting it anyway:

AACGTTAGTACCAAGGGAACGGAATTTCAAGTGTGAGCTGATCCATCCCCTCTGTATGACGT

Good luck!

Historical Influences on Darwin

1. I believe that Malthus had the most influence on Darwin and his work: Through his studies of the relationship between population and food supply, Malthus provided the answer to his theory of natural selection.  Without this answer, Darwin’s theory would have lacked an explanation.

2. Malthus was mainly interested with population growth.  He pointed out that while populations tend to increase in size, the sources of food tend to stay the size they are.  In his written work An Essay on the Principle of Population, he discussed this issue, stating that the size of a population is always checked by the availability of resources.  Although he acknowledged that humans can make efforts to increase this availability, he promoted methods to reduce the population itself instead of accommodating it.  He classified these methods as either positive, where the death rate was increased, or preventative, where the birth rate was decreased.

[What I find interesting is that Malthus was willing to tolerate the decrease of population through the allowance of war, disease, starvation, and even infanticide.  Admittedly, his insistence that essentially killing off part of the population was more practical than finding ways to accommodate a larger one disturbs me slightly.  Although it seems that he is concerned for the betterment of humankind as a whole, I can’t help but feel he didn’t have a high regard for the lives of individuals.  What is more interesting is despite his concern for betterment, he did not believe in eugenics; he found the idea impractical and unrealistic.  I would have thought that someone with his outlook would be very supportive of this practice, but even though he promoted the elimination of individuals to decrease population, it doesn’t seem like he was very concerned with who was eliminated or who remained living (although what I read does suggest that several positive checks, including starvation and disease, would mostly affect the poor).]

Sources: http://www.econlib.org/library/Enc/bios/Malthus.html

   http://www.victorianweb.org/economics/essay.html

3. Two bullet points especially affected by Malthus’ findings are

• Something is keeping organisms from reproducing to their full potential
• This “something” is limited resources

Malthus’ findings allowed Darwin to add these points to his theory.  Without them, he would have never been able to explain how natural selection would be able to happen.

4. Darwin would not have been able to move forward without Malthus’ findings.  He expanded on Malthus’ idea by applying it to the animal population, and concluded that because some species had better access to the limited resources (because they are better placed in their environment, or had traits that were better adapted to their environment), they were able to survive the species who did not.  These surviving species were able to reproduce and pass these better traits down to their offspring.

5. Because the most widely accepted explanation of variation within species was based on a literal interpretation of the Bible, Darwin was very hesitant to publish his theory of natural selection.  The former explanation proposed that all species had been fixed since the time they had been created, meaning there had been no change since they had appeared on earth.  As well as going against the teachings of the Bible, Darwin’s theory challenged all prevailing beliefs about natural history in Great Britain at the time.  If he made this theory public, he thought would be seen as a heretic.  Furthermore, he did not feel that he had enough data to support his theory if he did decide to publicize it.  It wasn’t until many years later, when Alfred Wallace began writing essays about natural selection, that Darwin finally published his studies in his work “The Origin of Species”.

Test post: hello!

This is a test post to see if it will show up on my blog.

Hi everyone, my name is Maia.  I'm taking Anthro 101 this summer to complete my GE.  I'm a theatre major, and it's definitely an interesting field to be in.  If any of you came to see COC's "Rent", you might have seen me running around in shiny blue tights and screaming foul words at the guy with the camera and glasses.

I'm excited to be taking this class this semester.  Hope to be hearing from you all!